---
title: "Introduction to baseq"
output: rmarkdown::html_vignette
vignette: >
  %\VignetteIndexEntry{Introduction to baseq}
  %\VignetteEngine{knitr::rmarkdown}
  %\VignetteEncoding{UTF-8}
---

```{r, include = FALSE}
knitr::opts_chunk$set(
  collapse = TRUE,
  comment = "#>"
)
```

```{r setup}
library(baseq)
```

## Introduction

`baseq` is a basic sequence processing tool for biological data. It provides simple and efficient functions for common tasks in molecular biology, such as cleaning sequences, translating DNA/RNA to protein, and calculating GC content.

## Sequence Cleaning

You can clean DNA or RNA sequences by removing any non-standard characters. The universal `clean_seq()` function automatically detects the type.

```{r cleaning}
dna_seq <- "ATGCnNryMK"
clean_seq(dna_seq)

rna_seq <- "AUGGCuuNnRYMK"
clean_seq(rna_seq)
```

## Translation

`baseq` can translate DNA and RNA sequences into protein sequences in all six reading frames.

```{r translation}
dna_seq <- "ATCGAGCTAGCTAGCTAGCTAGCT"
proteins <- dna_to_protein(dna_seq)
proteins[["Frame F1"]]
```

## GC Content

Calculate the GC content of a DNA sequence.

```{r gc}
dna_seq <- "ATGCATGC"
gc_content(dna_seq)
```

## Reading and Writing Files

`baseq` provides universal functions to read and write FASTA and FASTQ files.

```{r files, eval = FALSE}
# Read a FASTA file into a dataframe
# df <- read_seq("path/to/file.fasta")

# Write a dataframe to a FASTA file
# write_seq(df, "output.fasta")
```

For more details, see the documentation for individual functions.